b'Next-Generation Sequencing (NGS) | Research Use Only (RUO) AssaysBioinformatics Software Next-Generation Sequencing (NGS) | RUO AssaysLymphoTrack Bioinformatics SoftwareSoftware Use Operating System: Windows 7 (64-bit) is required.The LymphoTrack Bioinformatics Software package is provided withJava 8 for 64-bit operating systems or higher (Java configured for each LymphoTrack Assay to analyze raw FASTQ files for clonality32-bit operating systems is not compatible with the LymphoTrack analysis of single or multiple target data sets (IGHV Leader (Leader),SoftwareMiSeq or LymphoTrack Software - S5/PGM). The most IGH FR1, IGH FR2, IGH FR3, IGK, TRG, TRB). For data generated withrecent version of Java can be downloaded directly from Oracle at LymphoTrack IGHV Leader or IGH FR1 Assays the software provideshttp://www.java.com/.additional information, including the rate of somatic hypermutationA PDF reader, such as Adobe Acrobat Reader, to visualize data (SHM) and whether a clone will be functional based upon thereports generated by the LymphoTrack Reporter.presence of a premature stop codon. The software can also predictMicrosoft Office Excel 2007, 2010, or 2013 with Macro support whether an open reading frame would be in- or out-of-frame, so noenabled is required for data visualization.external data analysis is required for sample interpretation.The provided software is composed of two distinct parts:A CD-ROM drive.1.A bioinformatics Data Analysis ApplicationThe LymphoTrack Software - MiSeq has been validated for use with Windows 7 configured for English (United States) language 2. Microsoft Excel Data Visualization spreadsheets for each geneand default display size settings, and Microsoft Excel target and automated Sample-to-PDF Reports for streamlined 2007/2010/2013 for alternate data visualization. Use of other data analysis. Windows/Excel versions and/or language/display size settingsmay not be compatible.Minimum Software Requirements The LymphoTrack Software - S5/PGM has been validated for use with Microsoft Excel 2007/2010/2013/2016 and Windows 7 or Processor: Intel Core 2 Duo or newer CPU recommended. Windows 10 configured for English (United States) language and Hard Drive: At least 80 GB of free disk space is required; 250 GBdefault display size settings, and for alternate data visualization. recommended. Use of other Windows/Excel versions and/or language/display sizeRAM: 4 GB required; 8 GB or more recommended. settings may not be compatible.Sequence Frequency GraphLymphoTrack IGH Assay - V - J Sequence FrequenciesLymphoTrack IGH Assay -V J Sequence Frequencies65 Unique sequenceCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGG GCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCC 4 AGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAG CCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGT ACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT% Total Reads % Total Reads3 Gene rearrangement familyIGHV1-46_03 -IGHJ4_02 210The stacked bar graph depicts the top 200 sequencing reads for a sample. Each individual colored bar represents a unique population of cells. Different colors stacked at the same point on the x-axis represent unique sequences that utilize the same V and J gene families. The amplicons of these products vary in sequence and may also vary in product size. 48'