b'Next-Generation Sequencing (NGS) | CE-IVD AssaysBioinformatics Software Next-Generation Sequencing (NGS) | CE-IVD AssaysLymphoTrack Dx Bioinformatics SoftwareSoftware Use Operating System: Windows 7 (64-bit) is required.The LymphoTrack Dx Bioinformatics Software package is providedJava 8 for 64-bit operating systems or higher (Java configured for with each LymphoTrack Dx Assay to analyze raw FASTQ files for32-bit operating systems is not compatible with the LymphoTrack clonality analysis of single or multiple target data sets (IGHV Leader,Dx SoftwareMiSeq or LymphoTrack Dx Software - S5/PGM). The IGH FR1, IGH FR2, IGH FR3, IGK, TRB, or TRG). For data generated withmost recent version of Java can be downloaded directly from LymphoTrack Dx IGHV Leader or IGH FR1 Assays, the software providesOracle at http://www.java.com/.additional information, including the rate of somatic hypermutationA PDF reader, such as Adobe Acrobat Reader, to visualize data and whether a clone would be functional based upon the presencereports generated by the LymphoTrack Reporter.of a premature stop codon. The software can also predict whether anMicrosoft Office Excel 2007, 2010, or 2013 with Macro support open reading frame would be in- or out-of-frame. enabled is required for data visualization.The provided software is composed of two distinct parts:A CD-ROM drive.1.A bioinformatics Data Analysis ApplicationThe LymphoTrack Dx Software - MiSeq has been validated for use 2. Microsoft Excel Data Visualization spreadsheets and automatedwith Windows 7 configured for English (United States) language Sample-to-PDF Reports for streamlined data analysis for VJ usage and default display size settings, and Microsoft Excel and VJ sequence frequency graphs. 2007/2010/2013 for alternate data visualization. Use of other Windows/Excel versions and/or language/display size settingsmay not be compatible.Minimum Software Requirements The LymphoTrack Dx Software - S5/PGM has been validated for Processor: Intel Core 2 Duo or newer CPU recommended. use with Microsoft Excel 2007/2010/2013/2016 and Windows 7 or Windows 10 configured for English (United States) language and Hard Drive: At least 80 GB of free disk space is required; 250 GBdefault display size settings, and for alternate data visualization. recommended. Use of other Windows/Excel versions and/or language/display sizeRAM: 4 GB required; 8 GB or more recommended. settings may not be compatible.Sequence Frequency Graph * If a CD-ROM drive is not available, please contact us at:
[email protected] IGH Assay - V - J Sequence FrequenciesLymphoTrack Dx IGH Assay - V - J Sequence FrequenciesLymphoTrack IGH Assay -V J Sequence Frequencies65 Unique sequenceCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGG GCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCC 4 AGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAG CCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGT ACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT% Total Reads % Total Reads3 Gene rearrangement familyIGHV1-46_03 -IGHJ4_02 210The stacked bar graph depicts the top 200 sequencing reads for a sample. Each individual colored bar represents a unique population of cells. Different colors stacked at the same point on the x-axis represent unique sequences that utilize the same V and J gene families. The amplicons of these products vary in sequence and may also vary in product size.32'