b'Next-Generation Sequencing (NGS) | Research Use Only (RUO) AssaysBioinformatics Software Next-Generation Sequencing (NGS) | RUO AssaysLymphoTrack Bioinformatics SoftwareSoftware UseThe LymphoTrack Bioinformatics Software package is provided with each LymphoTrack Assay to analyze raw FASTQ files for clonality analysis of single or multiple target data sets (IGHV Leader (Leader), IGH FR1, IGH FR2, IGH FR3, IGK, TRG, TRB). For data generated with LymphoTrack IGHV Leader or IGH FR1 Assays the software provides additional information, including the rate of somatic hypermutation (SHM) and whether a clone will be functional based upon the presence of a premature stop codon. The software can also predict whether an open reading frame would be in- or out-of-frame, so no external data analysis is required for sample interpretation.The provided software is composed of two distinct parts: 1.A bioinformatics Data Analysis Application 2. Microsoft Excel Data Visualization spreadsheets for each gene target and automated Sample-to-PDF Reports for streamlineddata analysis.Sequence Frequency GraphLymphoTrack IGH Assay - V - J Sequence FrequenciesLymphoTrack IGH Assay -V J Sequence Frequencies65 Unique sequenceCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGG GCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCC 4 AGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAG CCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGT ACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT% Total Reads % Total Reads3 Gene rearrangement familyIGHV1-46_03 -IGHJ4_02 210The stacked bar graph depicts the top 200 sequencing reads for a sample. Each individual colored bar represents a unique population of cells. Different colors stacked at the same point on the x-axis represent unique sequences that utilize the same V and J gene families. The amplicons of these products vary in sequence and may also vary in product size. 54'