44 Next-Generation Sequencing (NGS) | Research Use Only (RUO) Assays Invivoscribe 2019 | 45 NGS RUO Assays LymphoTrackBioinformatics Software Software Use The LymphoTrack Bioinformatics Software package is provided with each LymphoTrack Assay to analyze raw FASTQ files for clonality analysis of single or multiple target data sets (IGHV Leader (Leader), IGH FR1, IGH FR2, IGH FR3, IGK, TRG, TRB). For data generated with LymphoTrack IGHV Leader or IGH FR1 Assays the software provides additional information, including the rate of somatic hypermutation (SHM) and whether a clone will be functional based upon the presence of a premature stop codon. The software can also predict whether an open reading frame would be in- or out-of-frame, so no external data analysis is required for sample interpretation. The provided software is composed of two distinct parts: 1. A bioinformatics Data Analysis Application 2. Microsoft Excel® Data Visualization spreadsheets for each gene target and automated Sample-to-PDF Reports for streamlined data analysis. Minimum Software Requirements • Processor: Intel Core 2 Duo or newer CPU recommended. • Hard Drive: At least 80 GB of free disk space is required; 250 GB recommended. • RAM: 4 GB required; 8 GB or more recommended. • Operating System: Windows 7 (64-bit) is required. • Java 7 for 64-bit operating systems or higher (Java configured for 32-bit operating systems is not compatible with the LymphoTrack Software – MiSeq or LymphoTrack Software - PGM). The most recent version of Java can be downloaded directly from Oracle at http://www.java.com/. • A PDF reader, such as Adobe Acrobat Reader, to visualize data reports generated by the LymphoTrack Reporter. • Microsoft Office Excel 2007, 2010, or 2013 with Macro support enabled is required for data visualization. • A CD-ROM drive. • The LymphoTrack Software – MiSeq v2.4.3 has been validated for use with Windows 7 configured for English (United States) language and default display size settings, and Microsoft Excel 2007/2010/2013 for alternate data visualization. Use of other Windows/Excel versions and/or language/display size settings may not be compatible. • The LymphoTrack Software – PGM v2.3.1 has been validated for use with Microsoft Excel 2007/2010/2013 and Windows 7 configured for the English (United States) language and default display size settings. Use of other Microsoft Excel/Windows versions and/or language/display size settings may not be compatible. Sequencing Summary Using the merged read summary, along with the easy to follow flow charts in the accompanying LymphoTrack Assay instructions for use (IFU), interpretation is quick and easy. Sequence Frequency Graph Ordering Information Catalog # Products Quantity Components 7-500-0009 LymphoTrack® Software- MiSeq® 1 CD complimentary with kit purchase 7-500-0007 LymphoTrack® Software - S5/PGM™ 1 CD complimentary with kit purchase The stacked bar graph depicts the top 200 sequencing reads for a sample. Each individual colored bar represents a unique population of cells. Different colors stacked at the same point on the x-axis represent unique sequences that utilize the same V and J gene families. The amplicons of these products vary in sequence and may also vary in product size. The read summary provides sequences from a sample ranked from most abundant to least prevalent. The total read count for individual sequences is provided and no independent analysis is required to determine V and J gene families and predictions for SHM when analyzing data from LymphoTrack IGHV Leader or IGH FR1 Assays. Additionally, the software provides raw and merged data in which reads that differ by 1-2 bp are automatically merged to account for possible sequencing errors and to improve the accuracy and ease of sample interpretation. combined. Rank Sequence Length Merge count V-gene J-gene % Total reads Cumulative % Mutation rate partial V-gene (%) In-frame (Y/N) No stop codon (Y/N) V-coverage 1 TTCTCGTGGTG 455 29603 IGHV4-59_08 IGHJ4_02 9.93 9.93 11.26 Y Y 98.63 2 CTCGCCCTCCT 463 205 IGHV5-51_01 IGHJ4_02 0.07 9.99 0.00 Y Y 99.66 3 GGTTTTCCTTG 484 201 IGHV3-7_01 IGHJ4_02 0.07 10.06 7.77 Y Y 100.00 4 CTCGCCCTCCT 463 185 IGHV5-51_01 IGHJ5_02 0.06 10.12 6.08 Y Y 99.32 5 CTCGCCCTCCT 469 170 IGHV5-51_01 IGHJ4_02 0.06 10.18 0.00 Y Y 99.32 6 CTCGCCCTCCT 466 160 IGHV5-51_01 IGHJ4_02 0.05 10.23 0.00 Y Y 99.66 7 CTGCTGCTGAC 460 159 IGHV2-5_10 IGHJ5_02 0.05 10.29 8.08 Y Y 97.64 8 GGTTTTCCTTG 493 156 IGHV3-48_02 IGHJ6_02 0.05 10.34 3.72 Y Y 98.99 9 CTCGCCCTCCT 334 153 IGHV5-51_02 IGHJ2_01 0.05 10.39 3.72 Y N 27.70 10 CTCGCCCTCCT 334 152 IGHV5-51_02 IGHJ2_01 0.05 10.44 3.38 Y N 26.01 Easy identification of specific types of gene rearrangements such as IGHV3-21. Identification of clonal sequences for follow up tracking with LymphoTrack MRD Software. SHM rate and indicators to determine whether a clone is productive. Only provided for IGHV Leader and IGH FR1. 1. Easy identification of specific types of gene rearrangements such as IGHV3-21. 2. Identification of clonal sequences for follow up tracking with LymphoTrack MRD Software. 3. SHM rates and indicators to determine whether a clone is productive. Only provided for IGHV Leader and IGH FR1. 1 2 3 2 3 1 0 1 2 3 4 5 6 % Total Reads LymphoTrack IGH Assay - V – J Sequence Frequencies LymphoTrack IGH Assay - V - J Sequence Frequencies % Total Reads Unique sequence CATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGG GCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCC AGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAG CCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGATCTCACAGGTTGTATTAGT ACCAGCTGCTATCCTCCGAACTACTTTGACTACTGGGGCCAGGGAACCCT Gene rearrangement family IGHV1-46_03 - IGHJ4_02 1. *MRD Software can be used to track sequences generated by either LymphoTrack Assays - MiSeq® or Ion S5/PGM™ MRD applications are for Research Use Only. To obtain a copy, please contact your local distributor or send an e-mail to MRD@invivoscribe.com